Adenovirus Fiber Knob expression and purification
The Ad5-FK gene fragment was amplified from pAD-Ad5 vector harboring adenovirus 5 genome as a template using the Phusion™ High-Fidelity DNA Polymerase and a pair of primers 5ʹTAAGAAGGAGATATAATGCATCATCATCATCATCACGGTGCCATTACAGTAGGAAACʹ3 and 5ʹGTGGTGGTGGTGGTGCTCGAGTTATTCTTGGGCAATGTATGAAAAʹ3. The forward primer included a 6-His tag and the oligonucleotide sequences encoding the first seven residues of the Ad5-22nd shaft repeat (GAITVGN), while the reverse primer included oligonucleotide sequences encoding the last six residues of the knob domain, SYIAQE (Fig. 1A) [12]. The amplified fragment was gel purified and inserted into the expression vector pET-28b downstream of T7 promoter using the In-Fusion Snap Assembly kit (Takara Bio, USA). The clones were screened by restriction enzyme digestion; the correct orientation and sequence of the insert gene were then verified with the double-strand sequencing. The recombinant pET28b-FK plasmid was introduced into the competent E. coli BL21 (DE3) cells for the expression of the Ad5-FK. The FK protein was purified by a two-step immobilized metal affinity chromatography (IMAC) approach using the Thermo Scientific HisPur Ni-NTA Purification Kit (Thermo Fisher Scientific, USA). Initially, the column was equilibrated using the equilibration buffer, and the protein sample was loaded onto the column. Thereafter, the captured proteins were eluted using the elution buffer (50 mM Tris-HCl, 0.1 M NaCl, 300 mM imidazole, pH 8.5) and then precipitated with 100% ammonium sulphate at 4 °C. After desalting using the Zeba Spin Desalting Column (7 K MWCO, Thermo Fisher Scientific, USA) with a buffer of 20 mM Tris-HCl at pH 8, the FK protein was refined using a 5-ml HiTrap TM QXL column (Cytiva). Initially, the column was equilibrated using ion-exchange buffer (20 mM Tris-HCl, pH 8). Next, the protein solution was injected onto the column for purification. The elution of FK was carried out with a linear gradient of elution buffer (20 m M Tris-HCl, 0.5 M NaCl, 1 mM EDTA, pH 7). Subsequently, the protein-containing fractions were pooled, concentrated through 100% ammonium sulfate precipitation, and then dialyzed against the final buffer (20 m M Tris-HCl, 1 mM EDTA, pH 8). The purified FK protein was validated on SDS-PAGE using Coomassie Brilliant Blue staining and by western blot using the HRP-conjugated anti-His tag monoclonal antibody (Thermo Scientific, USA). The concentration of the purified protein was measured using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, USA) in accordance with the manufacturer’s instructions. Synthesized N-His tagged last (22nd ) shaft repeat (SR; GAITVGN) of Ad5-fiber was used as a negative control in the experiments.
(A) Schematic diagram of adenovirus Fiber-Knob (FK)-based vaccine construct. The construct includes the knob part of the protein, the final (22nd ) shaft repeat of the adenoviral fiber and a 6-His tag at the N-terminal required for protein purification. (B)E. coli-expressed Ad5-FK (~ 22 KDa) on denaturing SDS-PAGE: FK protein was efficiently produced as a soluble protein with molecular weight of approximately 22 KDa. The purification process of the protein involved several steps including two consecutive IMAC steps using Ni-NTA columns (lanes 2–4 and 6), an intermediate step of ammonium sulfate precipitation (lane 5) and a final purification step using ion exchange chromatography (lane 7). (C) Native and denatured Ad5-FK on Coomassie Blue-stained SDS-PAGE gel. Purified FK without β-mercaptoethanol treatment (WO) was found to self-assemble into a trimer form of ~ 55 KDa, while no trimerization was detected in the β-mercaptoethanol-treated sample (W). (D) Western blot of native and denatured Ad5-FK using anti-His tag antibody. The trimerization pattern in the FK sample not treated with β-mercaptoethanol (WO), as observed on SDS-PAGE, was also confirmed by Western blotting
In vitro characterization of Ad5-FK by Electron Microscopy Visualization
For Electron Microscopy (EM) visualization and size determination, the purified Ad5-FK was subjected to Cryo-Electron Microscopy (Cryo-EM) analysis. The size of FK trimers (n = 120) was initially measured using the Image j software. Subsequently, the final size and distribution of the trimers was statistically determined using the SPSS-16 software.
Interaction of Ad5-FK with Cell receptors
To assess the ability of the recombinant FK to bind to the receptor of adenovirus susceptible cells, the binding between the purified Ad5-FK and HEK293 cells was visualized by fluorescence microscopy. To this end, on the Ibidi USA µ-Slide 8 Well (Ibidi, USA), HEK293 cells were incubated with the purified Ad5-FK at a concentration of 0.5 µg/ml at RT for 30 min. After three washes with 1×PBS, the cells were treated with the FITC-conjugated anti-His-tag Monoclonal Antibody (AD1.1.10; Thermo Fisher Scientific, USA) at a concentration of 5 µg/ml for 1 h at 37 °C. Following the antibody treatment, the cells were washed (×3) with 1×PBS, and subsequently were mounted using a mounting solution including DAPI stain before being examined under the fluorescence microscope CKK41 (Olympus, Germany) at a magnification power of 63×. Adenovirus SR peptide was served as a negative control for the assay.
Inhibition of Ad5 infection in HEK293 cells
Competitive inhibition of the recombinant Ad5-FK protein with the binding of HAd5V to cell receptors was tested in susceptible HEK293 cells. To this end, the cells were initially incubated with 11 different concentrations (5, 10, 20, 30, -100 ng/ml) of the purified FK at RT for 30 min. Following washing with 1×PBS, the cells were treated with recombinant replication-deficient adenovirus harboring the GFP reporter gene (rAd5-GFP), which was previously constructed in our lab, at an MOI of 5 for 45 min at RT. Although the rAd5-GFP virus is replication-deficient in normal cells due to deletion in the E1 region, the use of HEK293 cells, which stably express the E1A and E1B genes, allows for effective virus propagation in these cells. Following three washes with 1×PBS, the cells were incubated at 37 °C for an additional 18 h. The expression of the reporter GFP gene was then assessed by FACS using CytoFLEX Flow Cytometer (Beckman Coulter, USA). The adenovirus SR peptide was used as a negative control for the assay.
Mouse immunization
Eight-week-old BALB/c mice with a weight of 20–25 g (4 per group) were intramuscularly injected with the FK (50 µg), FK (50 µg) plus 10 µg c-di-AMP (InvivoGen, USA) as adjuvant, or PBS as negative control three times with 2 weeks’ interval. Two weeks after the last injection, the mice were sacrificed, serum samples and spleens were collected for the determination of anti-FK antibody titer and T-cell response analysis, respectively.
Antibody titration by FK-Based ELISA
FK-specific antibody concentrations were measured in mouse sera using a quantitative enzyme-linked immunosorbent assay (ELISA). To this end, ELISA plates were coated with 1 µg/ml FK overnight at 4⁰C. Two-fold serial dilutions of mouse IgG in 1×PBS, starting from 500 ng/ml, was used for the generation of a standard curve and quantitation of IgG concentration in the sera. After blocking the wells with 5% skimmed milk in 1×PBS for 2 h at RT, a 1 to 1000 dilution of sera in 1×PBS was added into the wells followed by 1.5 h incubation at RT. The wells were washed (×5) with washing buffer (1X PBS, 0.05% Tween 20) and then were treated with HRP-conjugated anti-mouse secondary antibodies for 1 h at RT. After five washing steps, the TMB substrate solution (Life technologies, USA) was applied to the wells; after 5 min incubation in dark at RT, the reaction was stopped with 0.16 M H2SO4, and absorbance values were measured at 450 nm using the Infinite F200 ELISA reader (Tecan, Germany). Antibody titers were finally measured using the IgG standard curve.
Virus neutralization assay
Inhibition of Ad5 infection in HEK293 cells was used to determine neutralization activity of anti-adenovirus antibodies produced in the vaccinated mice. Sera sample dilutions from mice groups were tested for their ability to inhibit adenovirus infection. HEK 293 cells were seeded at 2 × 105 cells per well in 96-well plates a day before the neutralization assay to reach 90–100% confluence. A fixed concentration (MOI = 1) of rAd5-GFP virus was incubated for 1 h at 37 °C either alone or with serial dilutions of sera (Six 2-fold serial dilutions for the serum samples starting at a 1:20). After incubation, 200 µl of each sample were applied to the cells and incubated for further 1 h at 37 °C to allow virus adsorption then the supernatant replaced with 200 µl of fresh 10% FBS DMEM. Finally, the GFP signals were recorded in each well after 24 h then the 100% neutralization titer was calculated. The 100% neutralization titer was recorded as the highest dilution of serum which yields no (0%) GFP signals in all infected wells (n = 5) relative to GFP signals in all wells (100%) treated with the virus alone at MOI = 1.
T-cell reactivation assay
Splenocytes-associated lymphocytes were isolated from the spleens of vaccinated mice as previously described [13]. The isolated cells were then stimulated with Ad5-FK overlapping 15-mer peptides overnight, along with 1 µg/ml Brefeldin A (Sigma-Aldrich, Germany). Cells were live/dead-stained with ethidium monoazidebromide (Invitrogen, USA). For surface T-cell marker analysis anti-CD8α (Pacific Blue-conjugated) and anti-CD4 (PE-conjugated) (eBiosciences, Germany) antibodies were applied. Intracellular cytokine staining (ICS) was performed using FITC anti-IFNγ, PE-Cy7 anti-TNFα and APC anti-IL-2 antibodies (eBiosciences, Germany) with help of the Cytofix/Cytoperm kit (BD Biosciences, Germany). Flow Cytometry data were acquired using CytoFLEX S, (Beckman Coulter, USA) and analysed with FlowJo software (Treestar, USA).
Statistical analysis
The data were analyzed by one-way ANOVA using the GraphPad Prism 9.5.0, and statistical significance was set at p < 0.05. The results were presented as means ± standard deviation (SD).
Add Comment