Bioinformatics analysis of the association between SUMO3 expression and pancreatic cancer
Using the RNAseq data from The Cancer Genome Atlas (TCGA) dataset, Gene Expression Profiling Interactive Analysis was performed to determine the SUMO3 level, which was compared between the pancreatic cancer and normal control groups. The Kaplan–Meier plot was used to estimate the correlation between SUMO3 and patient survival. The gene set enrichment analysis (GSEA) algorithm was used to discriminate the functional clustering associated high and low SUMO3 expression.
Patient samples
SUMO3 expression was determined using quantitative RT-PCR in 30 pancreatic cancer tissues obtained from patients who were recruited from October 2021 to March 2023 in the hospital. All patients provided written informed consent before tissue collection. Human pancreatic cancer tissue microarrays (Shanghai Outdo Biotech, China), which comprised 40 tumor tissues and 27 adjacent normal tissues, were used to determine SUMO3 protein expression on immunohistochemistry (IHC). Among the 40 patients with pancreatic cancer, SUMO3 expression was compared between 7 patients who were sensitive to chemotherapy (CR + PR) and 4 patients who were not (SD + PD). The experimental procedures involving human samples were approved by the medical ethics committee of Fudan University Shanghai Cancer Center (approval number 050432-4-2108) and were performed in accordance with the Declaration of Helsinki.
Immunohistochemistry
Paraffin-embedded tissues were sectioned to detect SUMO3 expression by IHC. Histological sections were sequentially reacted with anti-SUMO3 antibody (4971; Cell Signaling Technology, USA) and anti-IgG antibody (D-3004; Long Island Biotech, China). The H-score system, which ranged from 0 to 12, was applied to evaluate the immunoreactivity of the target protein by calculating the ratio of positive-staining cells to the color intensity. Scoring was performed independently by two investigators.
Cell lines and cell culture
The human pancreatic cancer cell lines (PANC-1, AsPC-1, SW1990, HPAC, and BXPC3) and control human pancreatic ductal epithelial (HPDE) cell line were purchased from the American Type Culture Collection. DMEM containing 10% fetal bovine serum, 1% streptomycin, and penicillin and a 5% CO2 cell incubator provided the nutrient and environmental conditions for cell growth.
For the experimental protocols, HPAC cells were transduced by a SUMO3 expression vector and stimulated by 10 µM of XAV939, which is an inhibitor of the Wnt/beta-catenin pathway, or 10 and 20 µM of GEM (Selleck, USA) for 48 h. SW1990 cells were transduced with the SUMO3 short hairpin RNA (shRNA) vector and treated with 10 and 20 µM of GEM and/or 5 mM of 2-DG (Selleck, USA) or different concentrations of BA (Selleck, USA) for 48 h.
Cell transfection
To achieve gene overexpression or knockdown, pancreatic cancer cells were transduced by pLVX-Puro-SUMO3 (oeSUMO3), pLKO.1-SUMO3 shRNA (shSUMO3), or pLVX-Puro-NF-κBp65 (oep65) vectors, which were constructed by GENERAL BIO (Chuzhou, China) using Lipofectamine 2000 (Invitrogen), according to the manufacturer’s instructions. The shRNA sequences targeting the human SUMO3 gene were as follows: shSUMO3#1 GCTCCGTGGTGCAGTTCAAGA, shSUMO3#2 TGGTGCAGTTCAAGATCAAGA, shSUMO3#3 GTGGTGCAGTTCAAGATCAAG, and scramble shRNA GGACGAGCTGTACAAGTAA. Cells transduced by blank pLVX-Puro vector (oeNC) or pLKO.1-scrambled shRNA served as the negative control.
Cell counting Kit-8 assay
Cell viability was measured using a Cell Counting Kit-8 (CCK-8) kit (Signaling Antibody, USA) according to the manufacturer’s protocols. Briefly, 3 × 103 cells were cultured in a 96-well plate overnight. At 12, 24, and 48 h after treatment, cells in each well were incubated with 10 µL CCK-8 solution for 1 h. Subsequently, the absorbance value at OD450 nm was detected on a microplate reader and translated into cell viability.
Cell apoptosis assay by flow cytometer
Cells were stained and incubated in Annexin V-FITC at 4 °C for 20 min, followed by propidium iodide for 20 min. Cell apoptosis was analyzed using an Accuri™ C6 flow cytometer.
Extracellular acidification rate
Cells were maintained in an XF-24 culture plate (Agilent Technologies, USA) at a density of 1 × 104/well for 24 h and then recultured in XF Base Medium (Agilent Technologies) 1 h before testing. Extracellular acidification rate (ECAR) was determined using an XF24 Extracellular Flux Analyzer (USA). During the test, glucose (1 µM), the ATP synthase inhibitor oligomycin (1 µM), and the glycolytic inhibitor 2-DG (0.5 µM) were used to stimulate cells at the test node.
Measurement of lactic acid and ATP
After normal cell culture for 12 h and another 24 h of reculture with fresh DMEM (50 µL/well), a culture supernatant of 3.5 × 103 cells/well in a 96-well plate was acquired and assessed for lactic acid content. ATP content was determined in the lysate that were acquired from cells cultured for 12–24 h in a 6-well plate. The lactic acid and ATP assay test kits used in this experiment were obtained from Nanjing Jiancheng Bioengineering Institute (China), and the protocols were followed according to the manufacturer’s instructions.
Quantitative RT-PCR analysis
Total RNA was extracted using TRIzol and used as the template for reverse transcription using Superscript II (Invitrogen, Shanghai). The cDNA product was amplified by quantitative RT-PCR (qRT-PCR) using SYBR master mix (Bio-Rad, USA). The primers used were as follows: SUMO3-F: 5′-ATGTCCGAGGAGAAGCCCAA-3′; SUMO3-R: 5′-ATTGACAAGCCCTGCCTCTCG-3′; β-actin-F: 5′-AGGATTCCTATGTGGGCGAC-3′; and β-actin-R: 5′-ATAGCACAGCCTGGATAGCAA-3′. Using β-actin as the reference gene, relative mRNA expression levels were calculated using 2−△△Ct.
DNA copy analysis of fecal samples from patients with pancreatic cancer
DNA was extracted using Stool Genomic DNA Extraction Kit (D2700; Solarbio Beijing, China) according to the manufacturer’s procedures. The DNA copy numbers of Faecalibacterium prausnitzii and Bifidobacterium were determined using qRT-PCR with Hieff® qPCR SYBR Green Master Mix (11203ES03; Yeasen Biotechnology Co., Ltd., Shanghai, China). The primer sequences were ACGCACATAGAAACAGTAG (F), TGTAGCCCAAGTCATAAAG (R) for Faecalibacterium prausnitzii and ATCGGGCTTTGCTTGGTGG (F), AGTCTGGGCCGTATCTCAGTC (R) for Bifidobacterium. pGM-T plasmids containing the bacterial DNA sequence were constructed by GENERAL BIO (Chuzhou, China) and used as the standard for qRT-PCR reactions.
Western blot
Cells were lysed using radioimmunoprecipitation assay lysis buffer (Beyotime, Shanghai, China). Nuclear and cytoplasmic fraction extracts were obtained using the NE-PER™ Nuclear and Cytoplasmic Extraction Reagents (Thermo Fisher Scientific, USA). The total protein in the sample was evaluated using the Bicinchoninic Acid Protein Assay Kit (Beyotime, China). The same content of the protein sample (20 µg) was subjected to SDS-PAGE to separate proteins of different weights and then transferred onto polyvinylidene fluoride membranes (Millipore, USA). Nonspecific proteins were blocked by 5% fat-free milk, and the target proteins were subsequently reacted with the primary antibodies anti-SUMO3 (ab203570, Abcam); anti-β-catenin (8480T, Cell Signaling Technology); anti-lactate dehydrogenase (LDHA) (3582T, Cell Signaling Technology); cleaved PARP (ab32064, Abcam); cleaved caspase 3 (PA5-114687, Invitrogen); anti-H3 (ab1791, Abcam); and anti-β-actin (60066-1-AP; Proteintech) and a secondary antibody (AB-2301, ZB-2305; ZSGB-BIO, Beijing, China). Blots of target proteins were visualized by chemiluminescence (Enhanced Chemiluminescence Detection Kit; Pierce Biotechnology, USA).
Luciferase reporter assay
Luciferase reporter assay was performed to identify the transcription activity of p65 on the SUMO3 promoter. The pGL3 wild-type SUMO3 promoter (WT) vector or the pGL3 mutant-type SUMO3 promoter (MUT), which was acquired by amplification and cloning of the promoter fragment into pGL3 vectors (Promega, USA), was combined with empty pGL3 or p65 overexpression vector-transduced cells (Lipofectamine 3000; Invitrogen, USA). At 48 h after transfection, the cells were collected and evaluated for luciferase activity using the Dual-Luciferase Reporter Assay System (Promega), as per the procedures provided by the manufacturer.
Chromatin immunoprecipitation assays
The interactions of specific proteins with gene promoters were evaluated using a chromatin immunoprecipitation (ChIP) assay (Magnetic ChIP kit; Millipore, USA). Briefly, cells immobilized with 1% formaldehyde were subjected to DNA fragmentation by sonication in the presence of MNase. Immunoprecipitation assays were conducted using the antibodies H3K9ac (ab32129, Abcam); H3K14ac (ab203952, Abcam); H3K27ac (ab4729, Abcam); or negative control IgG (30000-0-AP, Proteintech). The immunoprecipitate was eluted and subsequently subjected to reverse crosslinking. The precipitated DNA was amplified by PCR, and the target DNA was normalized to the input.
In vivo tumor-bearing mice model
Male BALB/c nude mice (5 weeks old) (Shanghai Lab. Animal Co., China) were used to establish a tumor-bearing model by subcutaneous injection of SUMO3 shRNA-transduced SW1990 cells or SUMO3 expression vector-transduced HPAC cells (n = 6 in each group). To examine the GEM sensitivity of the tumors, the mice were administered intraperitoneal GEM at 50 mg/kg once every 2 days. Tumor size was monitored every 3 days, and xenografts were collected for Ki67 immunofluorescence staining (27309-I-AP; Proteintech, USA) and TUNEL assay (Roche, USA). The animal studies were approved by the Ethics Committee of Fudan University (approval number 2020 Shanghai Cancer Center JS-213).
Data processing and analysis
Data were shown as mean ± standard deviation. Significant differences between groups were assessed using one-way analysis of variance or Student’s t-test. Statistical analyses were conducted using GraphPad Prism 8.4.2 software (USA). P values < 0.05 were considered significant.
Add Comment