Scientific Papers

Tenascin-C modulates alveolarization in bronchopulmonary dysplasia | Inflammation and Regeneration

Description of Image

Experimental animals and ethics statement

Pregnant C57BL/6 J mice at embryonic days 18–19 were obtained from the Laboratory Animal Center of Nanjing Medical University (Nanjing, China) and housed under specific pathogen-free conditions at Nanjing Medical University.

TN-C knockout mice on a C57BL/6 J background were obtained from Cyagen Biosciences (Suzhou, China). All animal treatments were in accordance with the guidelines approved by the Institutional Animal Care and Use Committee of Nanjing Medical University (IACUC-1708004).

Proteomics assay

Lung sample collection

The workflow of the study is presented in Fig. 1A. Briefly, developing pups designated for proteomics were euthanized at postnatal day (P) 1, 4, 7 or 14 by 200 mg/kg intraperitoneal (i.p.) injection of pentobarbital sodium. After aortic transection, a thoracotomy was performed, and the lungs were removed, dissected into individual lobes, and shortly rinsed with Dulbecco’s PBS (DPBS, Servicebio, Wuhan, China). The lung tissue samples were collected and snap-frozen in liquid nitrogen before being stored at -80 °C until needed.

Protein digestion and TMT tag labeling

The lung tissues were homogenized in RIPA working solution and subsequently centrifuged at 12,000 rpm for 10 min at 4 °C. The protein concentrations of the samples were determined by an Enhanced BCA Protein Assay Kit (Beyotime, Shanghai, China). To generate the peptides, 50 μg of protein was digested with 1 μg of trypsin (Promega, Madison, WI, USA) overnight at 37 °C. The peptides were subsequently labeled with TMT isobaric tags (Thermo Scientific, Rockford, USA) at RT for 1 h.

High-pH prefractionation

The labeled peptides were mixed into one component in equal amounts, and after desalting, the lyophilized peptide samples were reconstituted to 50 μl with mobile phase A (10 mM ammonium acetate aqueous solution, pH = 10) and separated under alkaline conditions using a C18 analytical column (XBridge BEH C18 XP Column, USA). The following gradient conditions were used: a liquid phase gradient of 60 min, mobile phase B (10 mM ammonium acetate; Sigma–Aldrich, St. Louis, MO, USA), 10% H2O, 90% acetonitrile (ANPEL Laboratory Technologies, Shanghai, China), and pH = 10.), 5% for 2 min, 5–30% for 40 min, 30-40% for 10 min, 40-90% for 4 min, 90% for 2 min, and 2% for 2 min. One component was collected every 1 min, collected in cycles, combined into 12 components, and stored at -80 °C after vacuum drying.

Nano-LC–MS/MS analysis

For each sample, 2 μg of total peptide was separated and analyzed with an UltiMate 3000 coupled to a Q Exactive HFX Orbitrap instrument (Thermo Fisher Scientific, USA) with a nanoelectrospray ionization source. Separation was performed using a reversed-phase column (Reprosil-Pur 120 C18-AQ, Dr. Maisch, Germany). The mobile phases used were H2O with 0.1% formic acid, 2% acetonitrile (phase A) and H2O with 0.1% formic acid and 80% acetonitrile (phase B). Separation of the sample was executed with a 90 min effective gradient at a 300 nL/min flow rate, and 0–10 min of sample loading was performed. Dependent acquisition (DDA) was performed in profile and positive mode with an Orbitrap analyzer at a resolution of 120,000 (@200 m/z) and a m/z range of 350–1600 for MS1; For MS2, the resolution was set to 45 k with a fixed first mass of 110 m/z. The automatic gain control target for MS1 was set to 3E6 with a maximum IT of 30 ms, and that for MS2 was set to 1E5 with a maximum IT of 96 ms. The top 20 most intense ions were fragmented by HCD with a normalized collision energy (NCE) of 32% and an isolation window of 0.7 m/z. The dynamic exclusion time window was 45 s, and single-charged peaks and peaks with charges exceeding 6 were excluded from the DDA [50].

Database search and quantification

The raw data files were searched and analyzed by Proteome Discoverer software (version 2.4.0.305; Thermo Fisher Scientific) and the built-in Sequest HT search engine. MS spectra lists were searched against their species-level UniProt FASTA databases (UniProt-Mus + musculus-10090-2021-8.fasta), with carbamidomethyl [C], TMT Pro (K) and TMT Pro (N-term) as fixed modifications and Oxi-dation (M) and acetyl (protein N-term) as variable modifications. Trypsin was used as a protease. A maximum of 2 missed cleavages was allowed. The false discovery rate (FDR) was set to 0.01 for both the PSM and peptide levels. Peptide identification was performed with an initial precursor mass deviation of up to 10 ppm and a fragment mass deviation of 0.02 Da. Unique peptides and Razor peptides were used for protein quantification, and the total peptide concentration was used for normalization. All the other parameters were set to their defaults.

Bioinformatics analysis

The original data contained 12 experimental samples. After screening for the number of unique peptides, proteins with a unique peptide number greater than or equal to 1 were retained, and 7660 proteins were retained after pretreatment. The data were logarithmically and centrally processed using R (version 3.6.3) or SIMCA software (version 16.0.2; Sartorius Stedim Data Analytics AB, Umea, Sweden). Statistical methods were used to screen differentially expressed proteins, and adjusted P values < 0.05 and fold change ≤ 0.67 or fold change ≥ 1.5 were considered to indicate statistical significance [51]. In this project, the Kyoko Encyclopedia of Genes and Genomes (KEGG) and pathway databases (www.kegg.jp/kegg/pathway.html) were used to search the Mus musculus (mouse) database. The significantly enriched metabolic pathways of the differentially expressed ECM proteins were also analyzed. K-means clustering was subsequently performed in combination with heatmaps to visualize the dynamic changes in ECM components related to lung development in neonatal mice.

Animal model of BPD

The murine model of BPD was established as described previously [52, 53]. Briefly, newborn mouse pups from several litters were mixed and divided into equal-sized cages of 6-8. Cages were then maintained in either indoor air (21% oxygen) or 85% oxygen within 12 h after birth until the day of harvest. The temperature (22 °C) and humidity (50-60%) were kept constant. To avoid oxygen toxicity in the dams and to eliminate maternal effects between groups, the nursing dams were rotated between the normoxic and hyperoxic groups every 48 h. All mice were maintained on a 12-h light–dark cycle. Mice were euthanized at P7 or P4 by injection of pentobarbital sodium (200 mg/kg i.p.).

To explore the role of TN-C in BPD pathogenesis, we treated TN-C-knockout pups with 85% oxygen to establish a BPD model. Wild-type BPD mice were used as the control group.

On postnatal days 2, 4, 6, 8 and 10, the mice were injected intraperitoneally with TN-C neutralizing antibodies or isotype rat IgG at 1 μg/g body weight in 10 μl of PBS. The mice were divided into three study groups: normoxic, hyperoxia + isotype and hyperoxia + TN-C neutralizing antibody.

H&E imaging

The pups were sacrificed by intraperitoneal injection of pentobarbital sodium. After being euthanized, the mice were tracheotomized, and the right lungs were removed and snap frozen for subsequent experiments. The left lungs were inflated and fixed with 4% paraformaldehyde (Servicebio, Wuhan, China) at a pressure of 25 cm H2O for ≥ 15 min. After isolation, the left lungs were fixed in 4% formalin at 4 °C overnight. Paraffin-embedded lung tissue blocks were sectioned at 5 μm and stained with hematoxylin and eosin (H&E) stain using standard staining procedures on the pathology platform of Servicebio Technology (Wuhan, China). Five randomly selected areas from 5 μm H&E-stained lung sections were captured at × 200 magnification with a microscope (model BX-53, Olympus Optical) under identical lighting conditions and optical settings by an investigator blinded to the grouping. Image analysis was performed using research-based digital image analysis software (ImageJ, JAVA). Radial alveolar counts (RACs) were measured by standard morphological techniques [54]. Briefly, respiratory bronchioles were identified as bronchioles lined by epithelium in one part of the wall. From the center of the respiratory bronchiole, a perpendicular line was dropped to the edge of the acinus (connective tissues or septum or pleura), and the number of septae intersected by this line was counted. The mean linear intercept (MLI), an indicator of mean alveolar diameter, was determined by superimposing a predetermined grid on the image, setting randomly placed lines, and counting the number of times the lines crossed an air-tissue interface [55].

Western blotting analysis

Total protein was extracted from cells or tissues by lysis with RIPA buffer containing protease and phosphatase inhibitor cocktails (Beyotime, Shanghai, China), after which the mixture was sonicated on ice 3 times for 20 s each. Protein concentrations were determined with a bicinchoninic acid (BCA) assay. Equal amounts of proteins were separated via SDS–PAGE. The proteins were separated by 10% SDS–PAGE and transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, Billerica, USA). The membranes were blocked for 1 h in 5% skim milk at room temperature and incubated at 4 °C overnight with the following primary antibodies: anti-TN-C (ab108930, Abcam), anti-HIF-1α (ab179483, Abcam), anti-β-actin (GB15003, Servicebio), anti-RAGE (ab216329, Abcam), anti-SFTPC (10774-1-AP, Proteintech) and anti-GAPDH (GB15004, Servicebio). The membranes were then washed three times with Tris-buffered saline containing Tween-20 (TBST) and incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (EarthOx Life Sciences, CA, USA) or goat anti-mouse IgG (H + L) HRP (s0002, Affinity Biosciences) for 1 h at room temperature. The antibody–antigen complexes were detected with Immobilon Western Chemiluminescent HRP Substrate (Millipore, MA, USA) and visualized using the G:Box gel doc system (Syngene, UK). For proteins in lung tissues and cells, β-actin was used as the internal control. For proteins in the supernatant, Ponceau S (P0022; Beyotime, Shanghai, China) was used as the loading control. The density quantification analysis was performed using software Image J.

Immunohistochemistry

Formaldehyde-fixed mouse lungs were dehydrated, paraffin-embedded, and sectioned (5 μm thickness). Antigen retrieval was performed in 10 mM citrate buffer (pH 6.0) in a pressure cooker for 10 min. Endogenous peroxidase activity was inhibited by adding 3% H2O2 solution to the slides for 15 min, followed by a 30-min blocking step in which 3% BSA was added to the PBS. The slides were then incubated for 1 h at room temperature (RT) with a rabbit monoclonal TN-C antibody (1:200, ab108930, USA). After the samples were washed with PBS, secondary antibodies conjugated to horseradish peroxidase (HRP) were added to the samples, which were subsequently incubated for 50 min at RT. Then, freshly prepared DAB chromogenic reagent was added to mask the tissues. Finally, the samples were mounted with hematoxylin staining solution and scanned by a digital tissue section scanner (Pannoramic MIDI, 3DHistech, Hungary). Images of the slides were captured by CaseViewer 2.4 viewing software (3DHistech, Hungary).

Cell culture and treatments

MLE-12 cells (CRL-2110, ATCC), a murine bronchial alveolar cell line, were cultured in DMEM (HyClone, USA), 10% fetal bovine serum (FBS, Lonsera, USA) and 1% penicillin/streptomycin (HyClone, USA). BEAS-2B cells (purchased from Procell Life Science & Technology Co. Ltd.), a kind of human bronchial epithelium, were cultured in complete bronchial epithelial cell growth medium (Lonza, CC-3170 and CC-4175). The cells were incubated in a humidified atmosphere of 5% CO2 at 37 °C. The cells were seeded in 24-well plates overnight and then exposed to room air (21% oxygen) or hyperoxia (85% oxygen) for 24 h. When needed, the HIF-1α inhibitor 2-MeOE2 (MCE, USA, S1233) or the HIF-1α agonist DMOG (MCE, USA, S7483) was added to the medium at a final concentration of 10 μM or 20 μM. The cells were harvested 12 h later for further analysis.

Cell transfection

293 T cells (CRL-3216, ATCC), a human embryonic kidney cell line, were seeded and incubated overnight before transfection. After mixing with Liposomal Transfection Reagent (Yeasen, China) in DMEM without FBS, penicillin or streptomycin for 25 min, the expression plasmid encoding TN-C (Vector Builder, China) was then transfected into 293 T cells at 90-95% confluence in DMEM for 48 h. The cell supernatant was harvested for further analysis. The blank vehicle plasmid was used as a control.

Cell proliferation and viability assay

Cell proliferation was detected by measuring active DNA synthesis using the Cell-Light™ EdU Apollo®567 Cell Tracking Kit (RiboBio, Guangzhou, China). The cells were seeded in 96-well plates at a density of 10000 cells/well and incubated overnight at 37 °C. Then, supernatant overexpressing the sTN-C protein and neutralizing TN-C antibody (MAB2138; R&D Systems, USA) were added to the culture media at concentrations of 2 or 8 ng/ml and 2 μg/ml, respectively. After incubating at 85% oxygen for 24 h, the fixed cells were treated with an EdU kit, and EdU incorporation was assessed via fluorescence. Changes in cell viability were determined by using the CCK-8 Cell Counting Kit (Vazyme Biotech Co., Ltd.). The absorbance values (OD450) were subsequently determined using a Multiscan microplate reader.

Cell migration ability assay

When the MlE-12 cells seeded in 24-well plates reached confluence, a single scratch was made using a sterile yellow pipette tip. Then, the cells were incubated with the sTN-C protein at a concentration of 2 nglml (low dose) or 8 ng/mL (high dose). After incubation at 21% oxygen for 24 h, images of the scratches were captured by an Olympus IX73 inverted microscope at × 100 magnification. To further visualize cell migration, scratched MLE-12 cells treated with 2 ng/ml sTN-C protein in 24-well plates were transferred to a temperature- and CO2-controlled (37 °C, 5% CO2) environment with a Zeiss Cell Discoverer microscope system. Live-cell phase-gradient contrast images of the individual field regions inside each well were automatically acquired using ZEN Blue 2.3 software. Representative figure images were selected, and additional image postprocessing steps were performed in ImageJ.

RNA extraction and high-throughput mRNA sequencing

After the cells were incubated with 2 ng/ml sTN-C protein (blank vector-transfected supernatant serving as a control) for 24 h, total RNA was isolated from the MLE-12 cells via a TRIzol reagent kit (Life Technologies, Carlsbad, CA, USA). To ensure the quality of the RNA, a Nanodrop was used to determine the purity of the RNA, and an Agilent 2100 was used to accurately determine the integrity of the RNA. When constructing the library, eukaryotic mRNA was first enriched with oligo (dT) magnetic beads, and fragmentation buffer was subsequently added to randomly interrupt the mRNA. Second, using mRNA as a template, the first cDNA strand was synthesized with six random primers, and then, buffer, dNTPs, RNase H and DNA polymerase I were added to synthesize the second cDNA strand. The cDNA was purified with AMPure XP beads. The purified double-stranded cDNA was then end repaired, added to the A tail and connected to the sequencing connector. Then, AMPure XP beans were used to determine the fragment size. Third, the cDNA library was obtained by PCR enrichment. After the construction of the library was completed, the library quality was tested, and computer sequencing was carried out only after the test results met the requirements. Finally, different libraries were pooled according to the target offline data volume and sequenced with the Illumina NovaSeq platform.

Quantitative real-time PCR

Total RNA was extracted from fresh lung tissue or cells with a TRIzol reagent Kit (Vazyme, China) in accordance with the manufacturer’s instructions. The mRNAs were reverse transcribed with cDNA synthesis supermix for qRCR (11141, Yeasen). Quantitative real-time PCR (qRT–PCR) was performed with a StepOnePlus Real-Time PCR System (ABI, USA). The reaction mixture contained 5 μl of Universal Blue SYBR Master Mix (11184, Yeasen), 3 μl of RNase-free water, 0.5 μl of primer, and 1 μl of template. We used the fold change (2CT) to show the expression of the mRNAs.

The sequences of primers used were as follows:

  • mouse Icam1 forward, GTGATGCTCAGGTATCCATCCA

  • mouse Icam1 reverse, CACAGTTCTCAAAGCACAGCG

  • mouse β-actin forward, GAGAAGCTGTGCTATGTTGCT.

  • mouse β-actin reverse, CTCCAGGGAGGAAGAGGATG.

Statistical analysis

All the data were subjected to testing for a normal distribution. All the data are expressed as the mean ± SEM, and all the statistical analyses were performed using GraphPad Prism 8. Single comparisons were conducted by unpaired t tests. Multiple comparisons were tested by using one-way ANOVA with Tukey’s adjustment. Survival study comparisons were performed using Kaplan–Meier analysis. For all analyses, statistical significance was set as follows: *, P < 0.05; **, P < 0.05; ***, P < 0.01; ****, P < 0.001; and ns, not significant.

Description of Image

Source link