Scientific Papers

Metformin normalizes mitochondrial function to delay astrocyte senescence in a mouse model of Parkinson’s disease through Mfn2-cGAS signaling | Journal of Neuroinflammation

Description of Image

Experimental animals

Mice (C57Bl/6 background) were housed under standard laboratory conditions (22 ± 1 °C, 12 h light–dark cycle, food and water ad libitum) in the Animal Resource Centre of the Faculty of Medicine (Nanjing Medical University). All procedures concerning animal care and treatment were carried out in accordance with the guideline of the Institutional Animal Care and Use Committee (IACUC) of Nanjing Medical University.

MPTP/p-induced PD mouse model

The MPTP protocol was carried out as described previously [23]. To evaluate the effect of metformin on cell senescence, the mice (male, 16–18 week) were injected subcutaneously with MPTP hydrochloride (25 mg/kg, Sigma-Aldrich, St. Louis, MO, USA) and then injected intraperitoneally with probenecid (250 mg/kg, Sigma, St. Louis, MO, USA) at 1 h interval for five consecutive days. One hour after first MPTP injection, mice were administered with metformin at 100 mg/kg/day for 2 week, Metformin was dissolved in drinking water and administered orally.

Preparation of Adeno-associated virus (AAV) particles

AAV particles (AAV-PHP.eB-GFAP promoter-shRNA (cGAS)-EGFP, 5.5 × 1012 vg/mL) were purchased from Shanghai GeneChem Co. (Shanghai, China). Short hairpin sequences (cat# GOSV0290175, sh1: 5′- GGATTGAGCTACAAGAATA-3′, sh2: 5′- GCTGTAACACTTCTTATCA-3′, 5′- GCTGGTCTTGAACAAAGAGAT-3′) were cloned into the AAV.

Stereotaxic injection

The stereotaxic injection was performed as previously described [24]. Under anesthesia, the 1.5 μL of AAV-PHP.eB-GFAP promoter-shRNA (cGAS)-EGFP (5.5 × 1012 vg/mL) was bilaterally injected into the substantia nigra pars compacta (SNpc) at a rate of 0.3 μL/min using the following coordinates: − 3.0 mm A/P, ± 1.3 mm M/L, and − 4.5 mm D/V from bregma.

Behavioral analysis

The behavior test was assessed at 7 days after the final injection of MPTP as described previously [25]. All behavioral analyses were carried out during the light cycle. For the pole test, the mice were placed head upward on the top of a vertical wooden rough-surfaced pole (diameter 1 cm, height 50 cm). The total time until the mouse reached the floor with its four paws (T-total) and the time needed for the mouse to turn completely head downward (T-turn) were recorded. For the rotarod test, mice were accustomed to the apparatus for 2 days, and then placed on the rod and tested at 20 rpm for 5 min. The latency time that mouse stayed on the rod at 20 rpm was recorded. For the open field test, locomotor activity of mice was detected in an activity monitor. The mouse was placed into activity monitor chambers (50 cm × 50 cm × 50 cm) for 30 min, and the activities were recorded at 5-min intervals.

Immunohistochemistry and immunofluorescence

Midbrain was cut into 30-μm slices to detect tyrosine hydroxylase (TH) using a freezing microtome (Leica M1950, Nussloch, Germany) as described previously [26], Brain slices were incubated with anti-TH antibody (T1299, 1:1000, Sigma, St Louis, MO, USA) overnight. After that, the brain slices were incubated with secondary antibodies for 1 h and then visualized by incubation in substrate-chromogen solution. The total number of TH-positive neurons in the SNpc were counted stereologically using the Optical Fractionator (Stereo Investigator 7, MBF bioscience, Williston, VT, USA).

For immunofluorescence staining, the slices or the astrocytes were incubated with anti-GFAP (MAB360, 1:1000 dilution, Millipore, Billerica, MA, USA), anti-TH (AB152, 1:2000 dilution, Sigma-Aldrich, USA), anti-IBA-1 (ab5076, 1:1000 dilution, Abcam), anti-lamin B1 (Abcam, ab16048, 1:400 dilution), anti-p16 (Santa Cruz Biotechnology, sc-56330, 1:200 dilution) or anti-cGAS (31659S, 1:400 dilution, Cell Signaling Technology, USA) overnight at 4 °C, followed by incubation in Alexa Fluor 555-conjugated antibody (Invitrogen, A21432; 1:1000) or Alexa Fluor 488-conjugated antibody (Invitrogen, A21202; 1:1000) for 1 h at 20 °C. The nuclei was stained with DAPI (P36931, Life Technologies). Images were obtained by a confocal microscope (Axiovert LSM510, Carl Zeiss Co., Germany) and then processed by Image J.

Quantitative RT-PCR (qPCR)

Total RNA from these cultured astrocytes and SNpc tissue was extracted with Trizol reagent (Invitrogen, USA). Reverse transcription PCR was performed using a TAKARA PrimeScript RT reagent kit and qPCR was carried out in duplicate for each sample using a QuantiTect SYBR Green PCR kit (Qiagen, Germany) with an ABI 7300 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). GAPDH was used as an internal control for the real-time PCR amplification. The sequences of primers used are as follows: IL-1β forward: TCATTGTGGCTGTGGAGAAG, reverse: AGGCCACAGGTATTTTGTCG. GAPDH forward: CAAAAGGGTCATCTCC, reverse: CCCCAGCATCAAAGGTG. p16Ink4a forward: CGCTTCTCACCTCGCTTGT, reverse: TGACCAAGAACCTGCGACC. IL-1α forward: AGTCAACTCATTGGCGCTTG, reverse: GAGAGAGATGGTCAATGGCAGA. IL-6 forward: TCCTTCCTACCCCAATTTCCA, reverse: GTCTTGGTCCTTAGCCACTCC. MMP-3 forward: GTTCTGGGCTATACGAGGGC, reverse: TTCTTCACGGTTGCAGGGAG. MMP-9 forward: CGACTTTTGTGGTCTTCCCC, reverse: AGCGGTACAAGTATGCCTCTGATTTCCA.

Culture and treatment of mouse primary astrocytes

Primary astrocyte was cultured as described previously [27]. The neonatal midbrain (P0-3) was trypsinized with 0.25% trypase at 37 °C for 10 min and then centrifuged for 5 min at 1000g centrifugation. The cells were resuspended in Dulbecco’s modified Eagle’s medium (DMEM)/Ham’s F12 medium containing 10% fetal bovine serum (FBS, GIBCO, Gaithersburg, MD, USA) and plated onto T-75 flasks at 50,000 cells/cm2. After 10 d, confluent mixed glial cultures were shaken at 220 rpm for 6 h at 37 °C to remove unwanted cell types (microglia, oligodendrocytes, neurons, and fibroblasts). The purity of astrocytes was > 95% as determined with GFAP immunocytochemistry. To induce premature senescence model, astrocytes were pretreated with metformin at the indicated concentration for 1 h and then stimulated with MPP+ (200 μM, Sigma, St. Louis, MO, USA) for 24 h or α-synuclein aggregate (α-Syn PFF, 1 μg/mL, ab218819, abcam, USA) for 48 h. To induce naturally senescence model, astrocytes were cultured for 40 days and then treated with metformin for 10 days in vitro.

Cell transfection

For Mfn2 plasmid transfection, astrocytes were transfected with plasmids expressing Mfn2 (Hanbio Biotechnology Co., Ltd., Shanghai, China) in OPTI-MEM-reduced serum medium (Gibco, USA) using lipofectamine 3000 reagent (Invitrogen, Life Technologies) for 48 h according to the instructions provided.

Mesencephalic primary neuron cultures and treatment

Mesencephalic primary neuron cultures were prepared from the ventral mesencephalic tissues of C57BL/6 mice on embryonic day 14/15 (E14/15). Briefly, mesencephalic cells were dissociated by trypsinization (0.25% trypsin and 0.02% EDTA in Ca2+– and Mg2+-free Hanks’ balanced salt solution) at 37 °C for 10 min, followed by gentle triturating in plating medium (h-DMEM supplemented with 10% fetal bovine serum and 10% horse serum). Cells were seeded onto poly-l-lysine-coated 24-well plates at a density of 2.5 × 105 cells per cm2 and incubated at 37 °C in 5% CO2 atmosphere. After cell adherence, the medium was replaced by neurobasal medium supplemented with 2% B-27 (Gibco-BRL) and 0.5 mM l-glutamine (Sigma) and treated with 1 μM cytosine arabinoside (Sigma) for 24 h to inhibit glial cell proliferation. Half of the culture medium was replaced every 3.5 days. Cultures were used after 7 days in vitro. Astrocytic conditioned medium (ACM) was collected and centrifuged at 1000g for 5 min to remove debris and dead cells. Mesencephalic primary neurons were incubated with the supernatant mixed with neurobasal medium at a ratio of 1:2 for 24 h before immunocytochemical staining.

Quantification of neuron count and neuronal processes

As described previously [28], mesencephalic primary neurons were stimulated with astrocytic conditioned medium (ACM) for 24 h. The cells were incubated with anti-MAP2 antibody (ab32454, Abcam, USA) at 4 °C overnight and then incubated with Alexa Fluor 488-conjugated antibody for 1 h at 20 °C. Neurons were counted and the total length of cell processes was quantitated using Image Pro Plus 5.1.

Measurement of cytosolic mtDNA

Astrocytes were divided into two equal aliquots. One aliquot was used to extract whole-cell DNA. To isolate cytosolic DNA, the cells in other aliquot were resuspended in digitonin lysis buffer containing 150 mM NaCl, 50 mM HEPES pH 7.4, and 25 μg/mL digitonin (Sigma-Aldrich). The homogenates were incubated on a rotator for 10 min at 20 °C and then centrifuged at 16,000g for 25 min. The supernatant was used for qPCR. The copy number of mtDNA (Nd1) obtained from cytosolic extracts was normalized to the copy number of nuclear DNA (Tert) obtained from the whole-cell extracts. The sequences of primers used are as follows: Nd1 forward: CAAACACTTATTACAACCCAAGAACA, reverse: TCATATTATGGCTATGGGTCAGG. nDNA Tert forward: CTAGCTCATGTGTCAAGACCCTCTT, reverse: GCCAGCACGTTTCTCTCGTT.

SA-β-gal staining

SA-β-gal staining was carried out with a β-galactosidase-based Senescence Cells Staining Kit (CS0030-1KT, Sigma-Aldrich, USA) according to the manufacturer’s instructions. Astrocytes were fixed in 4% paraformaldehyde for 30 min at 20 °C and then stained with the SA-β-gal staining solution overnight at 37 °C. The positive senescent astrocytes stained blue were counted.

Measurement of mitochondrial superoxide

To detect superoxide in the mitochondria, astrocytes were stained with MitoSOX (M36008, Invitrogen, USA) at 2.5 μM for 30 min at 37 °C. After that, the cells were washed with PBS twice and then resuspended in cold PBS containing 1% FBS for flow cytometric analyses. Flow data were analyzed with the FCS Express software (Guava Easy Cyte™8, Millipore, USA).

For immunofluorescence, astrocytes were incubated with MitoSOX at 2.5 μM for 30 min at 37 °C and washed twice with PBS. DAPI visualizes nuclei. Images were acquired by a confocal microscope. Mitochondria-associated ROS levels were assessed by fluorescence intensity using Image J.

Determination of mitochondrial membrane potential

To determine mitochondrial membrane potential, astrocytes were stained with 10 μg/mL JC1 (T-3168, Invitrogen, USA) for 30 min at 37 °C and then washed with PBS twice. After that the cells were resuspended in cold PBS containing 1% FBS for flow cytometric analyses. Flow data were analyzed with the FCS Express software (Guava Easy Cyte™8, Millipore, USA).

For immunofluorescence, astrocytes were incubated with JC1 for 30 min at 37 °C and washed twice with PBS. The cells then were incubated with DAPI for 10 min to visualize nuclei. Images were observed by a confocal microscope.

Western blotting analysis

Brain tissues and astrocytes were lysed in RIPA lysis buffer. Each 30 μg protein was separated and then transferred onto PVDF membranes (IPVH00010, Millipore, MA, USA). The membranes were blocked with 10% milk for 1 h at 25 °C and then incubated with anti-p16 (ab211542, abcam, USA), anti-p-sting (72971S, Cell Signaling Technology, USA), anti-cGAS (31659S, Cell Signaling Technology, USA), anti-TH (MAB318, 1:1000, Millipore, Billerica, MA, USA), anti-Mfn2 (ab56889, abcam, USA), anti-p-AMPK (50081, Cell Signaling Technology, USA) and anti-β-actin (BM0627, Boster, Pleasanton, CA, USA) antibody overnight at 4 ◦C. Immuno-reactive bands were detected by ImageQuant™ LAS 4000 imaging system (GE Healthcare, Pittsburgh, PA, USA) and analyzed using ImageJ software.

Statistical analysis

All data were analyzed using Prism7 software and were expressed as means ± SEM. The differences among different treatments and genotypes were assessed by one-way or two-way analysis of variance (ANOVA), followed by the Tukey’s post hoc test. The results were considered significant at p < 0.05.

Description of Image

Source link