Animals
Male APP/PS1 (APPswe and PSEN1dE9) mice were purchased from the Animal Model Research Center of Nanjing University (Nanjing, China) and maintained by Gene&PeacebiotechCo., Ltd., (Guangzhou, China). All procedures were approved by the Animal Care and Use Committee of Tongji Hospital, Tongji Medical College of Huazhong University of Science and Technology.
Plasmids
The whole circRIMS2 sequence was cloned into the pcircRNA-1 circRNA overexpression vector (Additional file 1: Fig. S1a) purchased from BersinBio (Guangzhou, China).
RNA sequencing
Total RNA was isolated from hippocampus with TRIzol reagent (Thermo Fisher Scientific, Carlsbad, CA), and was quantified with Qubit 3.0 Spectrophotometer (Thermo Fisher Scientific). The sequencing libraries for mRNA and circRNA were generated by TruSeq Stranded Total RNA Library Prep Kit (Illumina, San Diego, CA). The sequencing libraries for miRNAs were generated by TruSeq small RNA sample Preparation kit (Illumina). The libraries were sequenced on a Hiseq 2500 platform (Illumina). Clean reads were aligned to the reference genome mm10 using HISAT2.
Unmapped reads were used to identify circRNAs using CIRI2. miRBase was used as reference to find known or novel miRNAs with miRDeep2. The mapped reads of mRNA were assembled by Stringtie.
Aβ oligomer preparation
Aβ42 oligomers were prepared as described previously [18]. Aβ42 peptide (Chinapeptides, Wuhan, China) was dissolved in 100% hexafluoroisopropanol at 1 mM, followed by vacuum to remove hexafluoroisopropanol. The peptide was resuspended in dimethyl sulfoxide at a concentration of 5 mM, diluted to 100 μM with F12 culture medium, and further incubated for 24 h at 4 °C. The solution was centrifuged for 20 min at 13,000 rpm, and the supernatant was used.
RNA antisense purification (RAP) assay
For RAP assay, an RAP Kit (BersinBio, Guangzhou, China) was used following the manufacturer’s protocol. Biotin-labeled circRIMS2 probe (biotin-5′-TGATCCCTGGACACTGATGGACTTCGTTTTTTCTCTCCAATGTTCCCTTTGGTGGAAGCT-3′-biotin) and scramble control probe (biotin-5′-GCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCA-3′-biotin) were synthesized by BersinBio (Guangzhou, China). Briefly, cross-linked cells were lysed, sonicated, and then hybridized with the probe for 4 h at 37 °C. The hybridization mixture was then treated with C1 magnetic beads (Invitrogen, Carlsbad, CA) for 1 h. After that, the bound proteins were cleaned and prepared for silver staining and mass spectrometry analysis.
Morris water maze (MWM)
A platform was placed below the water surface in one of the quadrants of the maze. Each mouse underwent five consecutive days of training, with three trials each day. At the beginning of each trial, a mouse was placed in one quadrant, and the trial ended once it found the platform and stayed there for at least 3 s. If the mouse failed to find the platform in one minute, it was manually led to the platform and allowed to stay on it for 15 s. On day 7, after a day of rest, the mice were tested. A video camera (Techman, Chengdu, China) was placed 2 m above the water surface to capture the swimming path, the latency to find the platform, the duration in the target zone, and the speed.
Novel object recognition (NOR) test
One day before the habituation test, the mice were placed in the arena without any objects for 5 min. On the training day, two objects, designated A and B, were introduced to the arena and the mice were allowed 5 min to explore. After the training session, the equipment and arena were thoroughly cleaned with 75% (v/v) ethanol. On the testing day, subject B was replaced with a brand-new subject C. A video camera was used to capture mouse behavior, and data were analyzed with the Any-maze behavior tracking software from Techman. The times the mice touched objects A and C were recorded as TA and TC, respectively. The preference for unfamiliar objects was calculated by dividing TC by the total exploration time (TA + TC).
Golgi-cox staining
After anesthesia with 2% pentobarbital sodium, the mouse brains were removed and immersed in Golgi staining solutions A/B for 14 days in darkness. Subsequently, the solutions A/B were replaced with solution C for 7 days at 4 °C in the dark. The 100-µm brain slices were prepared using the VT1200S vibratome (Leica, Wetzlar, Germany), and scanned using the VS120 microscope (Olympus, Tokyo, Japan) for the Sholl analysis, and the spine images were scanned using the Ni-E microscope (Nikon, Tokyo, Japan). The spine counts and Sholl analysis were assessed using ImageJ software (NIH, Bethesda, MD).
Western blotting (WB) and co-immunoprecipitation (Co-IP)
Cultured N2a cells were pre-treated with 10 µM of MG132 for 30 min to examine the ubiquitination of GluN2B following immunoprecipitation. The cells were further lysed with RIPA lysis buffer for 10 min, and supernatant was collected and treated with A + G agarose for 30 min at 4 °C, followed by centrifugation at 8000× g for 10 min at 4 °C. The supernatant was then incubated at 4 °C for 12–16 h with specified primary antibodies (GluN2B) and protein A + G agarose for co-immunoprecipitation. For tissue or cell Co-IP, supernatants were collected, treated with A + G agarose at 4 °C for 30 min, then centrifuged at 8000× g for 10 min at 4 °C. Then, the supernatants were incubated at 4 °C for 12–16 h with the primary antibody for UBE2K or GluN2B and protein A + G agarose. The agarose beads were washed, resuspended in 40 µl of SDS buffer, and further heated at 95 °C for 10 min. The supernatants were examined by WB [19].
Total protein concentrations were measured by the bicinchoninic acid assay. Protein samples were loaded onto 8%–15% SDS-PAGE gels, and transferred to PVDF membranes (Merck Millipore, Danvers, MA). The membranes were blocked with 5% non-fat milk before overnight incubation with primary antibodies. On the next day, the membranes were incubated with HRP-conjugated secondary antibodies at 25 °C. The blots were imaged using ECL substrate in the ChemiScope 6000 luminometer (Clinx, Shanghai, China) and analyzed using the ImageJ software. The antibodies are listed in Additional file 1: Table S1.
RNA isolation and real-time quantitative PCR (qRT-PCR)
RNA was isolated from cells or the hippocampus using TRIzol reagent. cDNA was synthesized with the cDNA Synthesis Kit (Yeasen, Shanghai, China), and qPCR experiments were conducted using the SYBR mix (TAKARA, Japan) in the ABI7500 machine (Applied Biosystem, Pleasanton, CA). The qPCR system included 1 μl of cDNA, 5 μl of SYBR Green master mix, and 0.5 μM of forward and reverse primers. The expression of circRNAs and miRNAs was normalized to GAPDH and U6, respectively. The primers used for qPCR were as follows: miR-3968-RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGGTGT, miR-3968-F: CGAATCCCACTCCAGACACCA, miR-3968-R: CCAGTGCAGGGTCCGAGGTATTC; U6-RT: AAAAATATGGAACGCTTCACGAATTTG, U6-F: GTGCTCGCTTCGGCAGCACATA, U6-R: GCGCAGGGGCCATGCTAATCTTC; circRIMS2-F: ATCAAGTACTCCGGGAACAG, circRIMS2-R: CTTTCTTCACTTTGCTCGTATC; UBE2K-F: AATCAAGCGGGAGTTCAAGG, UBE2K-R: TGTCTGGAGGTCCTGCTATTTC; RIMS2-F: AGGAATACCAGGCACGCTAC, RIMS2-R: ACATCACTGTGCCTTCTCTCAT; METTL3-F: AACATCTGTGGCCCCTGAAC, METTL3-R: TGGCGTAGAGATGGCAAGAC; GAPDH-F: GGCATCTTGGGCTACACTG, GAPDH-R: GTGGAAGAGTGGGAGTTGC.
Immunofluorescence and fluorescence in situ hybridization (FISH)
Primary mouse cortical neurons were initially seeded on glass coverslips and fixed with 4% paraformaldehyde in PBS for 30 min at 25 °C. Following this, cells were blocked with 3% BSA for 30 min at 25 °C and incubated with primary antibodies. The coverslips were washed and incubated with a secondary antibody for 1 h at 25 °C. The DAPI fluorescent dye was used to stain the nuclei. For FISH, the probes for circRIMS2 (red) and miR-3968 (green) were from Bersinbio (Guangzhou, China), and were hybridized with N2a cells at 42 °C for 20 h. The fluorescence of the cells was examined using LSM800 fluorescence microscope (Carl Zeiss, Germany).
Stereotaxic brain injection of virus
Lentiviruses that coded for UBE2K, shUBE2K, circRIMS2, or miR3968 were purchased from Viraltherapy (Wuhan, China) and had a virus titer of 5 × 108 TU/ml. Adeno-associated virus (AAV) serotype 9 that coded for shMETTL3 (CCTCCAAGATGATGCACATTT) was purchased from General Biol (Anhui) Co. Ltd. (Chuzhou, China) with a virus titer of 1E+12 vg/ml. All genes within the virus vector were promoted by the CMV-promoter. For hippocampal injection, mice were anesthetized and placed in a stereotaxic equipment, and were bilaterally injected with 1 μl of lentivirus or AAV (AP ± 2.5, DV -2.0, ML -2.0) at a rate of 1 μl/10 min. The needle of the syringe was kept in place for 10 min after injection.
Methylated RNA immunoprecipitation-quantitative PCR (MeRIP-PCR)
RNA was isolated from the hippocampus or cells using TRIzol reagent, and 1/10 of the RNA was kept as input. Prewashed Protein A/G Magnetic Beads (Tiangen, Beijing, China) were incubated with 5 μg of either rabbit immunoglobulin G (IgG) or anti-m6A antibody (Zenbio, Chengdu, China) at 4 °C for 2 h. After three washes, pure poly(A) RNA, 1 × IP buffer, and RNase inhibitors were combined with the antibody-conjugated beads. Following proteinase K digestion, the methylated RNA was precipitated using glycogen and 3 M sodium acetate overnight. The positions of circRIMS2 sequence-based m6A modification sites were predicted using SRAMP (http://www.cuilab.cn/sramp). The m6A enrichment of circRIMS2 was calculated via normalizing to the input. Further enrichment was determined by qPCR.
RNA immunoprecipitation
RNA immunoprecipitation was performed using an Imprint® RIP kit from Millipore. Briefly, 1 × 107 N2a cells were lysed with 150 μl of RNA immunoprecipitation lysis buffer, and the cell lysates were treated with magnetic beads coated with 5 μg of specific antibodies against mouse IgG or Ago (Abcam, Boston, MA) at room temperature for 4 h. The immunoprecipitated RNA was isolated by incubating the RNA–protein complexes with proteinase K digestion buffer after six rounds of washing, and were further used for qRT-PCR.
Add Comment